martes, 21 de julio de 2015

CSI: descubrir al asesino por las bacterias de su pelo


Aplicaciones forenses del análisis metagenómico de las bacterias presentes en el pelo

Seguro que habrás visto algún capítulo de la serie CSI en el que Grissom coge con sumo cuidado un pelo en la escena del crimen. Si el pelo en cuestión mantiene la raíz es relativamente fácil extraer el DNA y hacer un análisis del perfil genómico, que si coincide con el sospechoso, permite demostrar que el susodicho estuvo en la escena del crimen. Aunque el pelo es una de las muestras más empleadas en la investigación forense, a veces no permite un análisis tan preciso. Si el pelo es cortado o carece de raíz, la cantidad de DNA que se extrae es mucho menor y el análisis mucho más difícil.


El conjunto de microbios que viven en tu cuerpo se llama microbiota y todos los genomas de esos microbios es el microbioma. El estudio del microbioma humano ha demostrado que la composición de bacterias no solo es diferente en cada parte del cuerpo sino que también es distinta entre individuos, lo que podría ser interesante desde el punto de vista de la investigación forense.

Ahora por primera vez, a un grupo de australianos (1) se les ha ocurrido analizar la composición microbiana del pelo humano, para ver si podría tener interés forense. La pregunta que querían responder era si la composición bacterias del pelo es diferente según las personas y si esto podría ser empleado como herramienta forense adicional al análisis clásico del DNA.

Para ello, han empleado muestras de pelo de siete individuos sanos, tres hombres y cuatro mujeres de entres 23 y 53 años de edad. Además, dos de ellos eran pareja. Los voluntarios cogieron muestras de su propio pelo de la cabeza y del pubis, en tres tiempos diferentes, al comienzo del estudio y dos y cinco meses después. Se extrajo el DNA de las muestras, en concreto de tres pelos, se concentró el DNA, se amplificó mediante PCR y se realizó una secuenciación masiva. Los datos se analizaron bioinformáticamente para determinar la composición de bacterias en la muestra.

Los resultados demostraron que los datos obtenidos de las muestras de pelo del pubis tenían un mayor potencial para aplicaciones forense que los del pelo de la cabeza. El microbioma del pelo de la cabeza era muy similar en todos los individuos y no parece tener una aplicación forense clara.

La composición microbiana del pelo del pubis fue muy similar en cada persona a lo largo del estudio, lo que sugiere que es bastante estable. Además, el microbioma del pelo del pubis, a diferencia del pelo de la cabeza, parece estar menos influenciado por factores ambientales.


Sí que hubo diferencias entre sexos en la composición microbiana del pelo del pubis: el pelo de las mujeres tenía una mayor cantidad de bacterias del grupo Lactobacillus, prácticamente ausentes en el pelo de los hombres. Este dato, por ejemplo, permitía diferenciar claramente el origen del pelo según el sexo del indivuduo. La presencia de Lactobacillus se puede explicar porque este grupo bacteriano es característico y uno de los más frecuente en la vagina. Además, comparado con el pelo del pubis de los hombres, el de las mujeres tenía mayor diversidad microbiana.

Los datos obtenidos de las dos personas (un hombre y una mujer) que eran pareja fueron muy interesantes. El microbioma del pelo del pubis fue muy diferente entre ellos en las dos primeras muestras (tomadas al inicio y a los dos meses). Sin embargo, la composición fue muy similar en la última muestra, tomada en el quinto mes.  Resulta que, a diferencia de en las dos primeras muestras, esta pareja había mantenido relaciones íntimas antes de la toma de la última muestra de pelo. Según los investigadores, este resultado sugiere que durante el acto sexual puede haber también cierta mezcla de la microbiota, que explicaría, por ejemplo, la aparición de Lactobacillus en la última muestra del pelo del hombre. Las muestras de la pareja compartían más microbios que las de los individuos que no eran pareja.

Durante el acto sexual también puede haber transferencia de bacterias ente las dos personas

La comparación de todos lo datos sugiera también que todos los individuos tenían algunos grupos microbianos propios y únicos en la muestra de pelo del pubis, lo que podría llegar a tener valor en la investigación forense. Dicho de otra forma, se podría diferenciar el pelo de cada individuo por el perfil de bacterias presentes en el mismo.

Este estudio se ha realizado solo con siete individuos, y solo dos de ellos eran pareja. Como sugieren los mismos autores, son necesarios más análisis con un mayor número de muestras. Sin embargo, los datos sugieren que el análisis del microbioma del pelo del pubis puede ser tener interés como herramienta forense, especialmente en aquellos casos de un acto de violencia sexual. Este análisis podría ayudar a asociar a la víctima con el asaltante.

Habrá que estar atentos a la próxima temporada de CSI: seguro que incorporan esta nueva técnica entre sus análisis.

(1) Metagenomic analyses of bacteria on human hairs: aqualitative assessment for applications in forensic science. Tridico, S. R., y col. Investig Genet. 2014. 5 (1): 16. doi: 10.1186/s13323-014-0016-5.

viernes, 17 de julio de 2015

Las bacterias también se “vacunan”: el sistema CRISPR/Cas

Sobrevivir a una infección viral es fundamental para cualquier forma de vida. Para controlar una infección es necesario que el virus invasivo sea capturado por las células para su reconocimiento específico y posterior destrucción. Es lo que se denomina inmunidad adaptativa. En los mamíferos, este sistema se basa en la respuesta antígeno-anticuerpo. Pero las bacterias y las arqueas (los procariotas) no tiene este sistema de antígenos-anticuerpos. ¿Cómo se protegen entonces frente a una infección viral?

En los procariotas existe también un sistema de defensa que confiere inmunidad adaptativa frente a los virus (bacteriófagos) que les infectan, el denominado CRISPR/Cas del inglés “Clustered Regularly Interspaced Short Palindromic Repeats”, algo así como repeticiones palidrómicas cortas interespaciadas agrupadas regularmente, un nombre que seguro no te dice nada.

CRISPR/Cas es el sistema de defensa inmune adaptativo de las bacterias, capaz de reconocer un DNA extraño y degradarlo

¿Cómo es el sistema CRISPR/Cas?

El sistema CRISPR/Cas tiene dos componentes: un grupo de secuencias de DNA repetidas varias veces y agrupadas (CRISPR), y unas proteínas con actividad endonucleasa (Cas, del inglés “CRISPR-associated sequence”, secuencias asociadas a CRISPR).


Secuencias CRISPR/Cas en el cromosoma de una bacteria. El sistema incluye un conjunto, denominado array CRISPR, de varias secuencias de DNA espaciadoras alternadas con secuencias palindrómicas (*) repetidas. Estas secuencia repetidas son idénticas y tienen un tamaño entre 21 y 47 pares de bases.  Las secuencias espaciadoras tienen un tamaño constante pero su secuencia de DNA es hipervariable y derivan del DNA de bacteriófagos y plásmidos con los que la bacteria ha tenido contacto previamente. Todo el array CRISPR se transcribe como un único RNAm, bajo el control de una secuencia promotora reguladora que se encuentra en la secuencia leader.  Además, existen otros genes asociados a CRISPR, denominados genes Cas, del inglés “CRISPR-associated sequences” que codifican para las proteínas Cas con actividad endonucleasa y que cortan el DNA extraño reconocido.

El primer artículo que hace referencia a este sistema es de 1987 (1), en el que analizan el genoma de Escherichia coli y describen por primera vez unas secuencias que se repetían una y otra vez, separadas por otras secuencias a las que denominaron espaciadores. Varios años después, en el 2000, el español Martínez Mójica (2) de la Universidad de Alicante describió esas mismas secuencia en arqueas y las denominó SRSRs, Short Regularly Spaced Repeats. Hoy sabemos que las secuencias CRISPR/Cas se encuentran en aproximadamente el 40% de los genomas de las bacterias secuenciados y el 90% de los de las arqueas. El sistema es más complejo y ya se han descrito de momento tres tipos diferentes de sistemas CRISPR/Cas en procariotas.

Entrevista al investigador Francisco J. Martínez Mójica en El Mundo (29/05/2015)

Mediante el sistema CRISPR/Cas los procariotas son capaces de incorporar a su genoma un fragmento del DNA invasor que servirá de guía para evitar futuras invasiones

¿Cómo funciona CRISPR/Cas?

CRISPR/Cas es un sistema de defensa que permite a la bacteria interferir con la infección de un fago. Pero no lo hace ni bloqueando la entrada del fago o de su DNA, ni mediante el sistema enzimático clásico de restricción-modificación, ni mediante un sistema que aborte la infección viral. El sistema es mucho más sofisticado y se activa cuando la bacteria es infectada por un virus que inyecta su DNA extraño al interior de la bacteria. Parte del DNA del virus (o de un plásmido) se incorpora como secuencia espaciador en el genoma de la bacteria entre las secuencias CRISPR. Posteriormente, se transcribe el array CRISPR y se produce un RNA de interferencia que contiene esa secuencia CRISPR espaciadora incorporada. Este RNA es capaz de guiar a las enzimas Cas hacia una secuencia de DNA complementaria (de un nuevo virus similar al anterior que infecte la bacteria) y degradarlo.  Las enzimas Cas, por tanto, son guiadas por el RNA y cortan y empalman el DNA donde le “dice” el RNA.

Es un efectivo sistema de defensa de la bacteria (sistema inmune adaptativo) contra el virus. Podríamos decir que la bacteria queda “vacunada” contra ese virus. Además, la secuencia del virus a destruir queda así almacenada como información en el genoma de la bacteria y de sus descendientes.

CRISPR/Cas es un sistema de defensa bacteriano que escanea el DNA extraño y si lo reconoce lo destruye


El array CRISPR se transcribe entero como un único RNAm que luego se corta en sitios específicos en cada repetición dando lugar a pequeños RNAs maduros (crRNAs, CRISPR RNA). Cada crRNA contiene una secuencia espaciadora entera más dos pequeños trozos de las regiones repetidas adyacentes. El corte preciso se hace por el complejo de proteínas Cas. Algunas de esta proteínas permanecen unidas al crRNA para formar un agente de defensa activo. La secuencia del espaciador del crRNA es capaz de reconocer y guiar al complejo a la secuencia diana específica, y entonces algunas de la proteínas con actividad endonucleasa cortan el DNA “invasor” . Como todos los espaciadores se transcriben y se procesan en agentes de defensa activos, la bacteria está continuamente en guardia frente a cualquier fago o plásmido invasor.

Una nueva revolución en biología molecular

Después de la invención de la PCR y de los nuevos sistemas de secuenciación masiva, pocos pensaban que habría otra invención que volvería a revolucionar las técnicas de ingeniería genética y biología molecular. Pero el sistema de defensa bacteriano CRISPR/Cas está teniendo unas aplicaciones hasta ahora increíbles. El concepto es simple, modificando la secuencia del crRNA podemos hacer que el sistema corte la secuencia de DNA que nosotros queramos.

En 2012, la estadounidense Jennifer Doudna y la francesa Emmanuelle Charpentier publicaron en la revista Science (3) cómo el sistema CRISPR/Cas puede adaptarse para transformarlo en un método de edición genética muy preciso, eficaz, barato, sencillo, no tóxico, aplicable a todo tipo de DNA, de animales y plantas, que permite modificar el DNA, hacer mutaciones, inserciones, deleciones, y regular la expresión génica para editar y silenciar genomas.

CRISPR/Cas es el mejor “editor de textos” que se ha inventado hasta ahora para manipular el genoma de cualquier ser vivo


CRISPR/Cas ha transformado ya la tecnología en biología y sus aplicaciones biotecnológicas, biomédicas y de terapia génica son ya una revolución. La posibilidad de manipular la información genética mediante CRISPR/Cas abre la puerta a cambiar radicalmente el tratamiento y la investigación de un gran número de enfermedades y se considera ya uno de los principales hallazgos en la última década de la biomedicina. J. Doudna y E. Charpentier han sido galardonadas con el premio Princesa de Asturias de Investigación Científica y Técnica 2015.

De nuevo la revolución viene de la mano de las bacterias (y arqueas). Primero fueron las enzimas de restricción que actúan como unas “tijeras” capaces de cortar el DNA en sitios específicos. Luego las DNA polimerasas de arqueas permitieron el desarrollo de la amplificación específica de secuencias de DNA mediante la PCR. Y ahora, el sistema de defensa CRISPR/Cas. Ya nadie duda de que el algún día el Nobel premiará estas investigaciones.

Video sobre cómo funciona el sistema CASPR/Cas (en inglés, 4:12)



También te puede interesar “La revolución CRISPR/Cas” en Curiosidades de la Microbiología de Manuel Sánchez.

(*) Una secuencia palindrómica es una secuencia de ácido nucleico (DNA o RNA) que es lo mismo si se lee en una dirección en una hebra que en la otra dirección en la hebra complementaria, con la que forma una doble hélice. Por ejemplo:
ATTGGCGGTTAACCGCCAAT
TAACCGCCAATTGGCGGTTA


(2) Biological significance of a family of regularly spacedrepeats in the genomes of Archaea, Bacteria and mitocondria. Mojica, F. J., y col. Molecular microbiology, 2000; 36 (1): 244–246.

(3) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Jinek, M., y col. Science. 2012; 337 (6096): 816-21.
doi: 10.1126/science.1225829.


lunes, 13 de julio de 2015

La ardilla de oro: el juego de ciencia de este verano

La pregunta microBIO

El blog Metros por segundo, de Borja González Seoane ha organizado el mejor juego de ciencia de este verano: La ardilla de oro. 

Se trata de saltar de un blog a otro respondiendo una pregunta sobre un tema científico

El juego comienza ya: hoy lunes 13 de julio a las 11:00 am (hora peninsular española)
  
La pregunta microBIO es:
¿Cuál es la bacteria más grande que se conoce hasta ahora?


Para comenzar a jugar, aquí tienes el enlace a las instrucciones y a la primera pregunta del concurso La ardilla de oro, en Metros por Segundo

Ahora, tienes que saltar a la siguiente pregunta, 
en el blog de Félix Moronta

¿Te has perdido?
Siguiendo tu hoja de ruta, has llegado de DNA Didactisc y debes saltar al siguiente árbol, que es Félix Moronta.


Suerte y ánimo!, a por todas!

ATENCIÓN: Ya tenemos ganador de la primera edición de
 La ardilla de oro: enhorabuena!

La respuesta a nuestra pregunta ¿Cuál es la bacteria más grande que se conoce hasta ahora? es: Thiomargarita namibiensisuna bacteria marina filamentosa descubierta en 1999 capaz de oxidar el azufre, del grupo de las gamma-proteobacterias, con un tamaño de unas 750 micras. Está bacteria forma cadenas y acumula en su interior gránulos de azufre brillantes, por eso los autores le pusieron ese nombre que significa “perlas de azufre de Namibia”. De momento, es la bacteria más grande que se conoce. Referencia: Science.

jueves, 9 de julio de 2015

#microMOOC una cita vía Twitter con la microbiología

#microMOOC: un nuevo micro formato vía twitter de curso online masivo de libre acceso (Massive Open Online Course)

Durante los últimos meses, a través de mi cuenta de twitter @microbioblog, cada domingo, a la misma hora, de 22:00 a 22:30 (hora peninsular), con la etiqueta #microMOOC, he impartido una “clase” de microbiología. Durante media hora aproximadamente, he “lanzado” aproximadamente un tuit por minuto. Ha sido una cita semanal con los microbios, los virus y las bacterias. Mucha información en media hora. No iba dirigido a especialistas, si no al público en general con ansias de saber un poco más de ciencia. Han sido “clases” a miles de personas al mismo tiempo en todo el mundo.

Luego, gracias a Storify, he ordenado todos los tuits para completar la historia completa, de forma que incluso los que no tienen cuenta de Twitter puedan seguir la “clase”. Son cientos de enlaces, imágenes, blogs, noticias, vídeos, infográficos sobre ciencia y microbiología, muy útiles también para tus clases.

Todas las clases vía Twitter de #microMOOC en un solo click


Aquí tienes acceso a cada clase por separado:

Biodiversidad escondida: un mundo invisible”. Características fundamentales del mundo de los microorganismos, de los tres dominios Bacteria, Archaea y Eukarya y las diferencias entre procariota y eucariota, del origen de la vida y evolución microbiana y pusimos algunos ejemplos de cómo trabajar con los microorganismos en el laboratorio.

La vida al filo de lo imposible: extremófilos”. Qué es un microorganismo extremófilo y qué tipos de extremófilos existen, algunas estrategias que han desarrollado los microorganismos extremófilos para poder vivir en esos ambientes y cómo se pueden emplear en biotecnología.

El ciclo de la vida y los microbios”.  Simbiosis Rhizobium-leguminosa.  Bacterias que intervienen en el ciclo del nitrógeno y en otros ciclos biogeoquímicos. El papel de los microorganismos en la digestión de los rumiantes.

Microbios y biotecnología”. Los microorganismos en procesos industriales y en biotecnología, energía microbiana, deterioro y biorremediación, ejemplos de ingeniería microbiana.

Nuestros microbios: la microbiota”. Características y componentes de la microbiota humana, el origen y función de la microbiota y su efecto en nuestra salud.

El lado oscuro de los microbios”. Los postulados de Koch, enfermedades infecciosas, bacterias resistentes a los antibióticos, causas y mecanismos de resistencia a los antibióticos, la relación entre cáncer y microorganismos.

El combate contra los patógenos”. Antibióticos y quimioterápicos, mecanismos de acción de los antibióticos, importancia de las vacunas y consecuencias del uso de antimicrobianos fraudulentos.

¿Se puede dar una clase vía Twitter? Sí, se puede!


¿Qué es un virus?”. Cómo es un virus, tamaño y estructura básica, diferencia entre virus y células, tipos de virus según su genoma y replicación, la clasificación de Baltimore.

Piratas de la célula”. Qué significa patógeno intracelular obligado, efecto citopático, cómo se replican los virus dentro de la célula, cómo actúan los antivirales.

Gripe: ¿una nueva alerta mundial?”. Qué es una pandemia y sus fases, tipos de virus de la gripe y por qué surgen nuevos virus, los nuevos virus de la gripe H5N1 y H7N9.

El origen de la pandemia del SIDA”. En qué consiste el SIDA, situación actual del SIDA en el mundo, cómo es la estructura del virus VIH, tipos y diversidad del VIH, origen del virus, por qué es tan difícil curar el SIDA.

Arbovirus: mosquitos y virus”. Qué son y cómo se transmiten los arbovirus, qué es una zoonosis, el virus del Nilo occidental, Dengue, Chikungunya y otros.

¿Porqué surgen nuevas infecciones virales?”. Virus emergentes, qué factores influyen en la aparición de nuevas infecciones virales, evolución viral, medio ambiente y virus, virus de origen animal, SARS, MERS, rabia.

Ébola: un año después”. ¿Cómo se originó?, ¿puede acabar siendo una pandemia?, ¿puede mutar y hacerse más virulento?, y después del Ébola, ¿qué?

"Ebola: one year later". La versión en inglés de "bola: un año después".

Las vacunas funcionan”. Tipos de vacunas, ¿cómo funcionan?, efectos secundarios, vacunas y autismo, el efecto rebaño, ¿hay que vacunarse?

Vaccines work”: La versión en inglés de “Las vacunas funcionan”

La sonrisa #microMOOC”. Quizá el mejor de todos, media hora para demostrar que la ciencia también puede ser divertida.


También hubo tiempo para un especial sobre “Louis Pasteur”, en el día de su cumpleaños, el 27 de diciembre.


Hasta la próxima!

sábado, 23 de mayo de 2015

El virus que resetea el sistema inmune

La vacuna contra el sarampión reduce también la mortalidad infantil frente a otras infecciones

El sarampión en una de las enfermedades infecciosa más contagiosas que existe (ver ¿Cuál es la enfermedad más contagiosa? en microBIO). Cuando el virus del sarampión te infecta te causa una inmunosupresión (una disminución de tus defensas) que te predispone a que puedas infectarte con otros patógenos oportunistas. Una infección oportunista está causada por un patógeno que normalmente no afecta a las personas sanas con un sistema inmune normal, pero que cuando el sistema inmune está débil aprovechan la “oportunidad” para causar una infección, por eso se llaman “oportunistas”. La inmunosupresión que causa el virus del sarampión puede durar desde unas semanas hasta meses. Esta inmunosupresión es la razón de que la mortalidad por sarampión esté causada típicamente por infecciones secundarias por otros patógenos del tracto respiratorio o digestivo.

El mecanismo concreto por el que el virus del sarampión causa esta supresión del sistema inmune no es del todo conocido. De hecho lo paradójico es que la fase aguda de la enfermedad está asociada con una supresión del sistema inmune pero con una activación e inducción de una potente respuesta inmune específica contra el virus del sarampión que resulta en una inmunidad de por vida. Es decir, que por un lado el virus del sarampión te disminuye tus defensas (y por eso te puedes infectar más fácilmente con otros patógenos), y por otro causa una respuesta inmune específica tan potente que hace que quedes protegido contra este virus de por vida, el sarampión solo se pasa una vez. No me negarás que es paradójico.

Un trabajo recién publicado en la revista PNAS (1) demuestra que este efecto inmunosupresor del sarampión puede llegar a durar entre 2 y 3 años. Los autores han empleado datos epidemiológicos poblacionales de Inglaterra, Gales, Estados Unidos y Dinamarca, y han encontrado que la incidencia de enfermedades infecciosas mortales distintas del sarampión está relacionada con la misma incidencia del sarampión.


Incidencia del sarampión y mortalidad infantil debido a enfermedades infecciosas distintas del sarampión en Inglaterra, Gales, Estados Unidos y Dinamarca. La línea vertical indica el año en el que comienza la vacunación contra el sarampión. Fuente: referencia (1).

La mortalidad infantil por enfermedades infecciosas distintas del sarampión se reduce significativamente después de las campañas de vacunación masiva contra el sarampión.

O sea que las secuelas que deja el sarampión influye en las fluctuaciones que hay de las muertas causadas por otros patógenos distintos del sarampión. Estos resultados eran además específicos de la vacunación contra el sarampión, como demuestra el hecho de que no se encontró ninguna correlación entre la vacunación contra la tos ferina y la reducción de la mortalidad por otras enfermedades infecciosas distintas.


Estos resultados son consistente con la hipótesis de que el sarampión produce una inmunosupresor por reducir la población de linfocitos B y T, las células del sistema inmune. Según los autores, el aumento de la infección por el virus del sarampión puede estar relacionado con más de la mitad de las muertes infantiles por otras enfermedades infecciosas. La reducción de la incidencia del sarampión es el principal factor para reducir la mortalidad infantil por infecciones.

La vacuna contra el sarampión no son solo previene esta enfermedad, sino que también reduce otras enfermedades infecciosas mortales.

La vacuna contra el sarampión se introdujo hace unos 50 años y ha originado una reducción significativa de la morbilidad y mortalidad infantil. El control del sarampión es reconocido como uno de los mayores éxitos de salud pública mundial. A pesar de esto, el sarampión continúa siendo responsable de cientos de miles de muertes al año en el mundo. Las campaña de vacunación han llegado a reducir la mortalidad infantil hasta en un 90% en algunos países. Esta reducción no se explica únicamente por la prevención del sarampión sino porque la vacuna reduce también la incidencia de otras infecciones. El virus tiene un efecto inmunosupresor que hace al huésped más susceptible a otras infecciones. La reducción de la mortalidad por las infecciones que causa la vacuna del sarampión puede llegar a durar los primeros cinco años de vida. Por eso, esta vacuna está relacionada con una reducción de todas las infecciones mortales infantiles.

Todo esto concuerda con los resultados de otros autores (2) que demuestran que la infección por el virus del sarampión provoca un perdida de las células memoria del sistema inmune adquiridas previamente, mientras que la vacunación previene este efecto. La infección por sarampión produce un recambio de las células memoria anteriores por linfocitos específicos contra el sarampión, lo que resulta en una especie de amnesia inmune contra otros patógenos distintos del sarampión. Esta “limpieza” de la memoria inmunológica que causa la infección por sarampión es la responsable de que aumente la susceptibilidad a los patógenos “oportunistas” que deberían ser controlados por un sistema inmune “sano”.

En conclusión: estos trabajos demuestran que la vacuna contra el sarampión reduce el número de muertes infantiles por otras enfermedades infecciosas y refuerzan la importancia de las campañas de vacunación masiva contra el sarampión. ¡Las vacunas funcionan!

También te puede interesar:



(1) Long-termmeasles-induced immunomodulation increases overall childhood infectious disease mortality. Mina, J. M., et al. 2015. Science. 348 (6235): 694-699. DOI: 10.1126/science.aaa3662

(2) Measles immune suppression: lessons from the macaque model. de Vries, R. D., et al. 2012. PLoS Pathog 8 (8): e1002885. DOI: 10.1371/journal.ppat.1002885

martes, 5 de mayo de 2015

50 tips to write your first research paper

  1. Write when you have something to say
  2. Focusing on your central message
  3. Write down the three central points of your paper
  4. Summarize your paper in one sentence
  5. Describe your work to a colleague in one minute
  6. Use a “sexy” title: Deoxyribonucleic acids are the carriers of the genetic information of cells in stead of A study of the biological role of the deoxyribonucleic acid components of cells
  7. Remember: Easy writing is hard reading, and hard writing is easy reading
  8. Never write in a hurry!
  9. Avoid verbosity: an excessive number or words
  10. Plan the structure of the manuscript
  11. Structure: abstract, keyword, introduction, material & methods, results, discussion, acknowledgements, references
  12. Write in order: first material and methods
  13. Second: tables and figures
  14. Third: Results
  15. Fourth: Discussion
  16. Finally: Introduction and acknowledgements
  17. Have the references needed at hand
  18. Material & methods: provide information that would make the work repeatable
  19. Just refer if the method is very well know
  20. Give a few hints on the critical steps if the method is well know
  21. Describe modification if the method is modified
  22. Describe in full if the method is new
  23. Results is the most important part of a paper
  24. Repeatability is essential in experimental research
  25. Prepare tables and figures of results first
  26. Then write a text that draws attention the relevant aspect of tables and figures
  27. Do not repeat exhaustively what table shows
  28. Discussion: make general statement summarizing your findings
  29. Discuss your findings including previous work
  30. Discuss uncertainties and discrepancies and explain why (if possible)
  31. Show the relevance for your hypothesis (established in the introduction)
  32. End discussion up pointing out future directions and conclusions
  33. Do not repeat the results in the discussion
  34. Introduction: the reader has to understand the importance of your work
  35. Provided with the main ideas to understand what follows
  36. Scope of the work: hypothesis, general and specific objectives
  37. No too narrow neither too broad
  38. Introduction should be short, clear and complete
  39. Acknowledgements: only contributions to the objective of the work should be acknowledged
  40. Acknowledge first people (with specific mention of the particular help the author is grateful for) and then the institutions supporting the work
  41. Abstract: start with a draft of the complete manuscript and follow these steps:
  42. Identify the major objectives and conclusions,
  43. Identify the phrases with keywords in the methods section
  44. Identify the major results from the discussion section
  45. Assemble the above information into a single paragraph
  46. State your hypothesis or method used in the first sentence
  47. Omit background information, literature and detailed description of methods
  48. Remove extra words and phrases
  49. Revise to see if it meets the guidelines of the targeted journal.
  50. Have your manuscript or draft reviewed by a labmate or colleague in the area, and your Major Professor of any person of similar experience
(*) Base on the conference How to write a research paper by Prof. Ignacio Moriyón (imoriyon@unav.es), Department of Microbiology and Parasitology, University of Navarra (Spain).